Review



immunofluorescent staining cenp f d6x4l rabbit mab cell signaling technology 58982t 250 immunofluorescent staining donkey anti mouse igg h l  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc immunofluorescent staining cenp f d6x4l rabbit mab cell signaling technology 58982t 250 immunofluorescent staining donkey anti mouse igg h l
    Immunofluorescent Staining Cenp F D6x4l Rabbit Mab Cell Signaling Technology 58982t 250 Immunofluorescent Staining Donkey Anti Mouse Igg H L, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/immunofluorescence+staining+mouse+antibody/CENP-F+Rabbit+mAb/pmc12446777__mmc1-0-159-165
    Average 93 stars, based on 20 article reviews
    immunofluorescent staining cenp f d6x4l rabbit mab cell signaling technology 58982t 250 immunofluorescent staining donkey anti mouse igg h l - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: IGF1R signaling drives antiestrogen resistance through PAK2/PIX activation in luminal breast cancer.
    Article Snippet: .. Antibodies and compounds, 3D culture, Western blot assay, and immunofluorescence staining Mouse antibody specific for PAK2 (#4825) and rabbit antibody against phospho-PAK1 (Ser144)/PAK2(Ser141) (#2606) were purchased from Cell Signaling, mouse antibody against E-cadherin (6101810) from BD Transduction, mouse antibody against β-PIX (611648) from BD Biosciences, and rabbit antibody against α-PIX (HPA003578) from Sigma. .. For other antibodies and compounds, and assays used, they were referred to those as previously described [14]. shRNA knockdown of PAK2 To establish shRNA-mediated PAK2 knockdown, we used two pLKO.1-puro lentiviral plasmids containing validated human PAK2 shRNA Seq1 (TRCN0000002115; Region: 3UTR; sequence: CCGGCTCTAGGAACCAAAGTGA TTTCTCGAGAAATCACTTTGGTTCCTAGAGTTTTT) or Seq2 (TRCN0000194671; region: CDS; sequence: CCGGCGGGATTTCTTAAATCGATGTCTCGAGACA TCGATTTAAGAAATCCC GTTTTTTG) (Sigma-Aldrich; in collaboration with Dr.

    Immunofluorescence:

    Article Title: IGF1R signaling drives antiestrogen resistance through PAK2/PIX activation in luminal breast cancer.
    Article Snippet: .. Antibodies and compounds, 3D culture, Western blot assay, and immunofluorescence staining Mouse antibody specific for PAK2 (#4825) and rabbit antibody against phospho-PAK1 (Ser144)/PAK2(Ser141) (#2606) were purchased from Cell Signaling, mouse antibody against E-cadherin (6101810) from BD Transduction, mouse antibody against β-PIX (611648) from BD Biosciences, and rabbit antibody against α-PIX (HPA003578) from Sigma. .. For other antibodies and compounds, and assays used, they were referred to those as previously described [14]. shRNA knockdown of PAK2 To establish shRNA-mediated PAK2 knockdown, we used two pLKO.1-puro lentiviral plasmids containing validated human PAK2 shRNA Seq1 (TRCN0000002115; Region: 3UTR; sequence: CCGGCTCTAGGAACCAAAGTGA TTTCTCGAGAAATCACTTTGGTTCCTAGAGTTTTT) or Seq2 (TRCN0000194671; region: CDS; sequence: CCGGCGGGATTTCTTAAATCGATGTCTCGAGACA TCGATTTAAGAAATCCC GTTTTTTG) (Sigma-Aldrich; in collaboration with Dr.

    Staining:

    Article Title: IGF1R signaling drives antiestrogen resistance through PAK2/PIX activation in luminal breast cancer.
    Article Snippet: .. Antibodies and compounds, 3D culture, Western blot assay, and immunofluorescence staining Mouse antibody specific for PAK2 (#4825) and rabbit antibody against phospho-PAK1 (Ser144)/PAK2(Ser141) (#2606) were purchased from Cell Signaling, mouse antibody against E-cadherin (6101810) from BD Transduction, mouse antibody against β-PIX (611648) from BD Biosciences, and rabbit antibody against α-PIX (HPA003578) from Sigma. .. For other antibodies and compounds, and assays used, they were referred to those as previously described [14]. shRNA knockdown of PAK2 To establish shRNA-mediated PAK2 knockdown, we used two pLKO.1-puro lentiviral plasmids containing validated human PAK2 shRNA Seq1 (TRCN0000002115; Region: 3UTR; sequence: CCGGCTCTAGGAACCAAAGTGA TTTCTCGAGAAATCACTTTGGTTCCTAGAGTTTTT) or Seq2 (TRCN0000194671; region: CDS; sequence: CCGGCGGGATTTCTTAAATCGATGTCTCGAGACA TCGATTTAAGAAATCCC GTTTTTTG) (Sigma-Aldrich; in collaboration with Dr.



    Similar Products

    96
    Cedarlane immunofluorescence staining
    Immunofluorescence Staining, supplied by Cedarlane, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/immunofluorescence+staining+mouse+antibody/Anti-Mouse%2FHuman+Mac-2+(Galectin-3)%2C+Purified+(Clone+M3%2F38)+(rat+IgG2a)/pmc12700951-67-7-14
    Average 96 stars, based on 1 article reviews
    immunofluorescence staining - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc immunofluorescent staining cenp f d6x4l rabbit mab cell signaling technology 58982t 250 immunofluorescent staining donkey anti mouse igg h l
    Immunofluorescent Staining Cenp F D6x4l Rabbit Mab Cell Signaling Technology 58982t 250 Immunofluorescent Staining Donkey Anti Mouse Igg H L, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/immunofluorescence+staining+mouse+antibody/CENP-F+Rabbit+mAb/pmc12446777__mmc1-0-159-165
    Average 93 stars, based on 1 article reviews
    immunofluorescent staining cenp f d6x4l rabbit mab cell signaling technology 58982t 250 immunofluorescent staining donkey anti mouse igg h l - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    98
    R&D Systems immunofluorescence staining primary
    Immunofluorescence Staining Primary, supplied by R&D Systems, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/immunofluorescence+staining+mouse+antibody/Human%2FMouse%2FRat+CD31%2FPECAM-1+Antibody/pmc11850275__DataSheet1-7-13-25
    Average 98 stars, based on 1 article reviews
    immunofluorescence staining primary - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    94
    R&D Systems immunofluorescence staining
    All groups consisted of intra‐articular injection with 10 µL of either saline control (CON), blank GSH (GEL: 488 1.5% gellan (w/v), 10 mM NaCl), methylprednisolone sodium succinate (PRED: 10 mg mL −1 ) or GSH loaded with methylprednisolone sodium succinate (PRED GEL: Gel: 1.5% gellan (w/v), 10 mM NaCl, Pred 10 mg mL −1 ). A) Representative image of Coomassie blue dye loaded gellan sheared hydrogel (GSH) administered into the intra‐articular space in the TNFtg murine model of polyarthritis. B) Body weight, C) disease score, and D) Inflammatory paw score D) measured over 21 days in the TNFtg model of polyarthritis following intra‐articular injection. E) Representative sagittal images of formalin‐fixed paraffin embedded knee joints, stained with hematoxylin and eosin, and F) measurement of synovitis, G) sub‐chondral pannus formation, and H) surface cartilage area in TNFtg animals at day 21 following treatment. I‐K) Fluorescence intensity/um 2 of synovial tissue as a measure of expression of TNFα and podoplanin, and representative images of fluorescent staining for RANKL, TNFa, podoplanin, and DAPI, determined by confocal <t>immunofluorescence</t> area in TNFtg animals at day 21 following treatment. L) Representative GILZ staining within synoviocytes was determined in the same groups within articular synovium by immunohistochemistry. M) Representative alcian blue staining within the articular space was performed in TNFtg animals after 21 days following injection with either saline control (Con) or GSH loaded with methylprednisolone sodium succinate at 20 and 60X magnification. Black arrows denote positively stained GSHs. Data are presented as mean ± SEM of at least three six animals per group. Statistical significance was determined using one‐way ANOVA with Tukey's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001). (scale bars, 50 µm).
    Immunofluorescence Staining, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/immunofluorescence+staining+mouse+antibody/Mouse+Podoplanin+Antibody/pmc11804841-272-7-14
    Average 94 stars, based on 1 article reviews
    immunofluorescence staining - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    Thermo Fisher goat anti-mouse igg (h+l) crossadsorbed secondary antibody, alexa fluor 647 (dilution for immunofluorescent staining 1:1000)
    All groups consisted of intra‐articular injection with 10 µL of either saline control (CON), blank GSH (GEL: 488 1.5% gellan (w/v), 10 mM NaCl), methylprednisolone sodium succinate (PRED: 10 mg mL −1 ) or GSH loaded with methylprednisolone sodium succinate (PRED GEL: Gel: 1.5% gellan (w/v), 10 mM NaCl, Pred 10 mg mL −1 ). A) Representative image of Coomassie blue dye loaded gellan sheared hydrogel (GSH) administered into the intra‐articular space in the TNFtg murine model of polyarthritis. B) Body weight, C) disease score, and D) Inflammatory paw score D) measured over 21 days in the TNFtg model of polyarthritis following intra‐articular injection. E) Representative sagittal images of formalin‐fixed paraffin embedded knee joints, stained with hematoxylin and eosin, and F) measurement of synovitis, G) sub‐chondral pannus formation, and H) surface cartilage area in TNFtg animals at day 21 following treatment. I‐K) Fluorescence intensity/um 2 of synovial tissue as a measure of expression of TNFα and podoplanin, and representative images of fluorescent staining for RANKL, TNFa, podoplanin, and DAPI, determined by confocal <t>immunofluorescence</t> area in TNFtg animals at day 21 following treatment. L) Representative GILZ staining within synoviocytes was determined in the same groups within articular synovium by immunohistochemistry. M) Representative alcian blue staining within the articular space was performed in TNFtg animals after 21 days following injection with either saline control (Con) or GSH loaded with methylprednisolone sodium succinate at 20 and 60X magnification. Black arrows denote positively stained GSHs. Data are presented as mean ± SEM of at least three six animals per group. Statistical significance was determined using one‐way ANOVA with Tukey's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001). (scale bars, 50 µm).
    Goat Anti Mouse Igg (H+L) Crossadsorbed Secondary Antibody, Alexa Fluor 647 (Dilution For Immunofluorescent Staining 1:1000), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/immunofluorescence+staining+mouse+antibody/pm39615487-829-155-163
    Average 90 stars, based on 1 article reviews
    goat anti-mouse igg (h+l) crossadsorbed secondary antibody, alexa fluor 647 (dilution for immunofluorescent staining 1:1000) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Proteintech immunofluorescent staining for ly6g
    Fig. 2. The acute inflammation rather than type II immune response around ECM scaffold membrane in aged wounds. (a) Schematic diagram for generating the scRNA-seq and spatial transcriptomics data from ECM mediated wound healing at POD7 in young and aged mice. (b) The UMAP reduction results reveals 13 different cell types in wounds. The marker genes are listed on the right of the annotation. (c) The annotated clustering results for spatial transcriptomic based on the anatomic structure of the wounds. (d) The proportion of each cell type of the whole wounds and their related wound healing process. (e) The upregulated results for Gene Sets Enrichment Analysis (GSEA) in ECM scaffolds treated aged wounds. (f) The AddModule scores of acute inflammation term in spatial transcriptomics expression. (g) The IF results for INOS and <t>LY6G</t> in Young_ECM and Aged_ECM at POD7. (Scale bars at the same column are the same) (h–i) The semiquantitative analysis of INOS and LY6G fluorescence area in (g) respectively. **P < 0.01 and *P < 0.05 by Student’s t-test (n = 5) for data in (h) and (i).
    Immunofluorescent Staining For Ly6g, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/immunofluorescence+staining+mouse+antibody/Anti-mouse+Ly-6G/pm38944969-111-21-26
    Average 93 stars, based on 1 article reviews
    immunofluorescent staining for ly6g - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology immunofluorescence staining anti par1 mouse santa cruz biotechnology sc 13503 na
    Fig. 2. The acute inflammation rather than type II immune response around ECM scaffold membrane in aged wounds. (a) Schematic diagram for generating the scRNA-seq and spatial transcriptomics data from ECM mediated wound healing at POD7 in young and aged mice. (b) The UMAP reduction results reveals 13 different cell types in wounds. The marker genes are listed on the right of the annotation. (c) The annotated clustering results for spatial transcriptomic based on the anatomic structure of the wounds. (d) The proportion of each cell type of the whole wounds and their related wound healing process. (e) The upregulated results for Gene Sets Enrichment Analysis (GSEA) in ECM scaffolds treated aged wounds. (f) The AddModule scores of acute inflammation term in spatial transcriptomics expression. (g) The IF results for INOS and <t>LY6G</t> in Young_ECM and Aged_ECM at POD7. (Scale bars at the same column are the same) (h–i) The semiquantitative analysis of INOS and LY6G fluorescence area in (g) respectively. **P < 0.01 and *P < 0.05 by Student’s t-test (n = 5) for data in (h) and (i).
    Immunofluorescence Staining Anti Par1 Mouse Santa Cruz Biotechnology Sc 13503 Na, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/immunofluorescence+staining+mouse+antibody/Thrombin+R+Antibody/pm37488908-169-80-84
    Average 93 stars, based on 1 article reviews
    immunofluorescence staining anti par1 mouse santa cruz biotechnology sc 13503 na - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    Bio-Rad immunofluorescence staining include rat anti mouse cd45 primary antibody
    Fig. 2. The acute inflammation rather than type II immune response around ECM scaffold membrane in aged wounds. (a) Schematic diagram for generating the scRNA-seq and spatial transcriptomics data from ECM mediated wound healing at POD7 in young and aged mice. (b) The UMAP reduction results reveals 13 different cell types in wounds. The marker genes are listed on the right of the annotation. (c) The annotated clustering results for spatial transcriptomic based on the anatomic structure of the wounds. (d) The proportion of each cell type of the whole wounds and their related wound healing process. (e) The upregulated results for Gene Sets Enrichment Analysis (GSEA) in ECM scaffolds treated aged wounds. (f) The AddModule scores of acute inflammation term in spatial transcriptomics expression. (g) The IF results for INOS and <t>LY6G</t> in Young_ECM and Aged_ECM at POD7. (Scale bars at the same column are the same) (h–i) The semiquantitative analysis of INOS and LY6G fluorescence area in (g) respectively. **P < 0.01 and *P < 0.05 by Student’s t-test (n = 5) for data in (h) and (i).
    Immunofluorescence Staining Include Rat Anti Mouse Cd45 Primary Antibody, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/immunofluorescence+staining+mouse+antibody/Rat+anti+Mouse+CD45/pm37914098-81-3-12
    Average 94 stars, based on 1 article reviews
    immunofluorescence staining include rat anti mouse cd45 primary antibody - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    All groups consisted of intra‐articular injection with 10 µL of either saline control (CON), blank GSH (GEL: 488 1.5% gellan (w/v), 10 mM NaCl), methylprednisolone sodium succinate (PRED: 10 mg mL −1 ) or GSH loaded with methylprednisolone sodium succinate (PRED GEL: Gel: 1.5% gellan (w/v), 10 mM NaCl, Pred 10 mg mL −1 ). A) Representative image of Coomassie blue dye loaded gellan sheared hydrogel (GSH) administered into the intra‐articular space in the TNFtg murine model of polyarthritis. B) Body weight, C) disease score, and D) Inflammatory paw score D) measured over 21 days in the TNFtg model of polyarthritis following intra‐articular injection. E) Representative sagittal images of formalin‐fixed paraffin embedded knee joints, stained with hematoxylin and eosin, and F) measurement of synovitis, G) sub‐chondral pannus formation, and H) surface cartilage area in TNFtg animals at day 21 following treatment. I‐K) Fluorescence intensity/um 2 of synovial tissue as a measure of expression of TNFα and podoplanin, and representative images of fluorescent staining for RANKL, TNFa, podoplanin, and DAPI, determined by confocal immunofluorescence area in TNFtg animals at day 21 following treatment. L) Representative GILZ staining within synoviocytes was determined in the same groups within articular synovium by immunohistochemistry. M) Representative alcian blue staining within the articular space was performed in TNFtg animals after 21 days following injection with either saline control (Con) or GSH loaded with methylprednisolone sodium succinate at 20 and 60X magnification. Black arrows denote positively stained GSHs. Data are presented as mean ± SEM of at least three six animals per group. Statistical significance was determined using one‐way ANOVA with Tukey's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001). (scale bars, 50 µm).

    Journal: Advanced Healthcare Materials

    Article Title: Structured Polymers Enable the Sustained Delivery of Glucocorticoids within the Intra‐Articular Space

    doi: 10.1002/adhm.202403000

    Figure Lengend Snippet: All groups consisted of intra‐articular injection with 10 µL of either saline control (CON), blank GSH (GEL: 488 1.5% gellan (w/v), 10 mM NaCl), methylprednisolone sodium succinate (PRED: 10 mg mL −1 ) or GSH loaded with methylprednisolone sodium succinate (PRED GEL: Gel: 1.5% gellan (w/v), 10 mM NaCl, Pred 10 mg mL −1 ). A) Representative image of Coomassie blue dye loaded gellan sheared hydrogel (GSH) administered into the intra‐articular space in the TNFtg murine model of polyarthritis. B) Body weight, C) disease score, and D) Inflammatory paw score D) measured over 21 days in the TNFtg model of polyarthritis following intra‐articular injection. E) Representative sagittal images of formalin‐fixed paraffin embedded knee joints, stained with hematoxylin and eosin, and F) measurement of synovitis, G) sub‐chondral pannus formation, and H) surface cartilage area in TNFtg animals at day 21 following treatment. I‐K) Fluorescence intensity/um 2 of synovial tissue as a measure of expression of TNFα and podoplanin, and representative images of fluorescent staining for RANKL, TNFa, podoplanin, and DAPI, determined by confocal immunofluorescence area in TNFtg animals at day 21 following treatment. L) Representative GILZ staining within synoviocytes was determined in the same groups within articular synovium by immunohistochemistry. M) Representative alcian blue staining within the articular space was performed in TNFtg animals after 21 days following injection with either saline control (Con) or GSH loaded with methylprednisolone sodium succinate at 20 and 60X magnification. Black arrows denote positively stained GSHs. Data are presented as mean ± SEM of at least three six animals per group. Statistical significance was determined using one‐way ANOVA with Tukey's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001). (scale bars, 50 µm).

    Article Snippet: The following primary antibodies were used for immunofluorescence staining of tissues: goat anti‐mouse podoplanin (R&D systems, AF3244,1 in 100), mouse anti‐mouse RANKL (Proteintech, Cat No: 66610‐1‐Ig, 1 in 100), and rabbit ant‐mouse TNF‐α (Proteintech, Cat. No: 80258‐6‐RR, 1 in 50).

    Techniques: Injection, Saline, Control, Formalin-fixed Paraffin-Embedded, Staining, Fluorescence, Expressing, Immunofluorescence, Immunohistochemistry

    Fig. 2. The acute inflammation rather than type II immune response around ECM scaffold membrane in aged wounds. (a) Schematic diagram for generating the scRNA-seq and spatial transcriptomics data from ECM mediated wound healing at POD7 in young and aged mice. (b) The UMAP reduction results reveals 13 different cell types in wounds. The marker genes are listed on the right of the annotation. (c) The annotated clustering results for spatial transcriptomic based on the anatomic structure of the wounds. (d) The proportion of each cell type of the whole wounds and their related wound healing process. (e) The upregulated results for Gene Sets Enrichment Analysis (GSEA) in ECM scaffolds treated aged wounds. (f) The AddModule scores of acute inflammation term in spatial transcriptomics expression. (g) The IF results for INOS and LY6G in Young_ECM and Aged_ECM at POD7. (Scale bars at the same column are the same) (h–i) The semiquantitative analysis of INOS and LY6G fluorescence area in (g) respectively. **P < 0.01 and *P < 0.05 by Student’s t-test (n = 5) for data in (h) and (i).

    Journal: Biomaterials

    Article Title: Integrated-omics profiling unveils the disparities of host defense to ECM scaffolds during wound healing in aged individuals.

    doi: 10.1016/j.biomaterials.2024.122685

    Figure Lengend Snippet: Fig. 2. The acute inflammation rather than type II immune response around ECM scaffold membrane in aged wounds. (a) Schematic diagram for generating the scRNA-seq and spatial transcriptomics data from ECM mediated wound healing at POD7 in young and aged mice. (b) The UMAP reduction results reveals 13 different cell types in wounds. The marker genes are listed on the right of the annotation. (c) The annotated clustering results for spatial transcriptomic based on the anatomic structure of the wounds. (d) The proportion of each cell type of the whole wounds and their related wound healing process. (e) The upregulated results for Gene Sets Enrichment Analysis (GSEA) in ECM scaffolds treated aged wounds. (f) The AddModule scores of acute inflammation term in spatial transcriptomics expression. (g) The IF results for INOS and LY6G in Young_ECM and Aged_ECM at POD7. (Scale bars at the same column are the same) (h–i) The semiquantitative analysis of INOS and LY6G fluorescence area in (g) respectively. **P < 0.01 and *P < 0.05 by Student’s t-test (n = 5) for data in (h) and (i).

    Article Snippet: For the evaluation the acute inflammatory molecules and immune cells infiltration, immunohistochemistry staining for CD3 (14-0032-82, Thermo Fisher Scientific, 1:100) and immunofluorescent staining for LY6G (65140-1-Ig, Proteintech, 1:200), INOS (22226-1-AP, Proteintech, 1:200), IL-1β (P420B, Thermo Fisher Scientific, 1:200),TNF-α (60291-1-Ig Proteintech, 1:200), OPN (22952- 1-AP, Proteintech, 1:200), F4/80 (29414-1-AP, Proteintech, 1:200), ARG1 (16001-1-AP, Proteintech, 1:150), IL-10 (ARC9102, Thermo Fisher Scientific, 1:100), CD62L (26477-1-AP Proteintech, 1:200), CD4 (67786-1-Ig, Proteintech, 1:500) were performed.

    Techniques: Membrane, Marker, Expressing, Fluorescence